英文互译镜像站

LRRC24

Last updated
LRRC24
Identifiers
Aliases LRRC24 , LRRC14OS, leucine rich repeat containing 24
External IDs MGI: 3605040; HomoloGene: 86785; GeneCards: LRRC24; OMA:LRRC24 - orthologs
Orthologs
SpeciesHumanMouse
Entrez
Ensembl
UniProt
RefSeq (mRNA)

NM_001024678

NM_198119

RefSeq (protein)

NP_001019849

NP_932787

Location (UCSC) Chr 8: 144.52 – 144.53 Mb Chr 15: 76.6 – 76.61 Mb
PubMed search [3] [4]
Wikidata
View/Edit Human View/Edit Mouse

Leucine rich repeat containing 24 is a protein that, in humans, is encoded by the LRRC24 gene. [5] The protein is represented by the official symbol LRRC24, and is alternatively known as LRRC14OS. [6] The function of LRRC24 is currently unknown. It is a member of the leucine-rich repeat (LRR) superfamily of proteins.

Contents

Gene

In humans, LRRC24 is located on Chromosome 8 (8q24.3). The gene spans approximately 4.66 kb on the opposite strand. [5] LRRC24 is composed of five exons, and only a single gene isoform has been identified. [5]

GeneCards Genomic View for LRRC24 gene Genomic View for LRRC24 Gene.png
GeneCards Genomic View for LRRC24 gene

Protein

General features

LRRC24 is a transmembrane protein of unknown function. Human LRRC24 consists of 513 amino acids including a 23 amino acid signal peptide. [5] [7] The mature form of the protein has a molecular weight of 52.9 kDa. [8] The isoelectric point of the mature human protein is 7.98 [9] The protein is largely composed of alpha helices. [10]

Domains

LRRC24 is a single-pass transmembrane protein. The protein consists of six leucine-rich repeats and an immunoglobulin-like domain. [5] [11]

FeaturePosition(s)Description
Signal Peptide1-23 [12]
Domain24-50Leucine rich repeat N-terminal domain (LRRNT) [13] [14]
Repeat51-72Leucine rich repeat 1 (LRR 1) [13] [14]
Repeat75-96LRR 2 [13] [14]
Repeat99-120LRR 3 [13] [14]
Repeat123-144LRR 4 [13] [14]
Repeat147-168LRR 5 [13] [14]
Repeat171-192LRR 6 [13] [14]
Domain204-257Leucine rich repeat C-terminal domain (LRRCT) [13] [14]
Domain259-364Immunoglobulin-like domain (Ig-like) [13] [14]
Domain406-426Transmembrane domain (TMEM) [15]
Motif427-436Arginine-rich motif (ARM) [13]
Diagram of LRRC24. Domains are labelled as predicted; grey markers represent confirmed N-linked glycosylated arginine residues (N334 & N363); red marker represents confirmed phorphorylated tyrosine (Y509); Figure created using Prosite MyDomains-Image Creator LRRC24 Protein Diagram.png
Diagram of LRRC24. Domains are labelled as predicted; grey markers represent confirmed N-linked glycosylated arginine residues (N334 & N363); red marker represents confirmed phorphorylated tyrosine (Y509); Figure created using Prosite MyDomains-Image Creator

Localization

LRRC24 is a secreted protein as is evidenced by the presence of a signal peptide. The structure of the protein suggests that it localizes to the cell membrane.

Homology

LRRC24 is conserved in Euteleostomi with the exception of Aves. [5] [18] Also, based on sequence homology analysis, distant orthologs of LRRC24 are also conserved in invertebrates of phyla Mollusca and Arthropoda. [5] No human paralogs of LRRC24 have been identified.

An unrooted phylogenetic tree of LRRC24 orthologs generated using Phylip's DrawTree and ClustalW. LRRC24 Orthologs Unrooted Tree .png
An unrooted phylogenetic tree of LRRC24 orthologs generated using Phylip’s DrawTree and ClustalW.

Expression

Microarray and in situ hybridization experiments suggest LRRC24 is primarily expressed within the brain. [20] [21] [22] Expression is observed to be especially high within the midbrain, neocortex, and tissues of the limbic system, including the hypothalamus and hippocampal formation. [20] [22] [23]

Interactions

Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. ROBO2 was found to interact with LRRC24. [24] [25] ROBO2 is a member of the Roundabout gene family, which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in synaptogenesis, as well as the maintenance of the nervous system in vertebrates. [25]

LRRC24 has also been found to interact with IGFBP7, a known regulator of insulin-like growth factors (IGFs). [25] IGFBP7 is also involved in the stimulation of cell adhesion.

Clinical significance

To date, no study has specifically implicated LRRC24 or the LRRC24 gene with any case of clinical significance. [26]

References

  1. 1 2 3 GRCh38: Ensembl release 89: ENSG00000254402 Ensembl, May 2017
  2. 1 2 3 GRCm38: Ensembl release 89: ENSMUSG00000033707 Ensembl, May 2017
  3. "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  4. "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  5. 1 2 3 4 5 6 7 "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-02-29.
  6. 1 2 "GeneCard". www.genecards.org. Retrieved 2016-05-09.
  7. "LRRC24 Gene (Protein Coding)". genecards.com. Retrieved February 22, 2016.
  8. Brendel V, Bucher P, Nourbakhsh IR, Blaisdell BE, Karlin S (March 1992). "Methods and algorithms for statistical analysis of protein sequences". Proceedings of the National Academy of Sciences of the United States of America. 89 (6): 2002–6. Bibcode:1992PNAS...89.2002B. doi: 10.1073/pnas.89.6.2002 . PMC   48584 . PMID   1549558.
  9. 1 2 Kozlowski LP (October 2016). "IPC - Isoelectric Point Calculator". Biology Direct. 11 (1): 55. doi: 10.1186/s13062-016-0159-9 . PMC   5075173 . PMID   27769290.
  10. Borrelli KW, Vitalis A, Alcantara R, Guallar V (November 2005). "PELE: Protein Energy Landscape Exploration. A Novel Monte Carlo Based Technique". Journal of Chemical Theory and Computation. 1 (6): 1304–11. doi:10.1021/ct0501811. PMID   26631674.
  11. "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-02-29.
  12. Petersen TN, Brunak S, von Heijne G, Nielsen H (September 2011). "SignalP 4.0: discriminating signal peptides from transmembrane regions". Nature Methods. 8 (10): 785–6. doi: 10.1038/nmeth.1701 . PMID   21959131. S2CID   16509924.
  13. 1 2 3 4 5 6 7 8 9 10 "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-05-09.
  14. 1 2 3 4 5 6 7 8 9 "NCBI Conserved Domain Search". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  15. Krogh A, Larsson B, von Heijne G, Sonnhammer EL (January 2001). "Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes". Journal of Molecular Biology. 305 (3): 567–80. doi:10.1006/jmbi.2000.4315. PMID   11152613.
  16. 1 2 "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  17. SIB Swiss Institute of Bioinformatics. "Prosite MyDomains - Image Creator".
  18. "HomoloGene - NCBI". www.ncbi.nlm.nih.gov. Archived from the original on September 15, 2016. Retrieved 2016-05-09.
  19. Thompson JD, Higgins DG, Gibson TJ (November 1994). "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucleic Acids Research. 22 (22): 4673–80. doi:10.1093/nar/22.22.4673. PMC   308517 . PMID   7984417.
  20. 1 2 "GDS868 / GATCCATTGCTGAGCTTGCG". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  21. "GDS3142 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  22. 1 2 "GDS3917 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  23. "Experiment Detail :: Allen Brain Atlas: Mouse Brain". mouse.brain-map.org. Retrieved 2016-05-09.
  24. Gilsohn E, Volk T (2010-01-01). "Fine tuning cellular recognition: The function of the leucine rich repeat (LRR) trans-membrane protein, LRT, in muscle targeting to tendon cells". Cell Adhesion & Migration. 4 (3): 368–71. doi:10.4161/cam.4.3.11606. PMC   2958611 . PMID   20404543.
  25. 1 2 3 Söllner C, Wright GJ (2009-01-01). "A cell surface interaction network of neural leucine-rich repeat receptors". Genome Biology. 10 (9): R99. doi: 10.1186/gb-2009-10-9-r99 . PMC   2768988 . PMID   19765300.
  26. "Home - dbVar - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
泛域名镜像 网站复制工具 自动镜像站群 一键镜像站群 关键词转码站群